ID: 1156961298_1156961304

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1156961298 1156961304
Species Human (GRCh38) Human (GRCh38)
Location 18:43034908-43034930 18:43034942-43034964
Sequence CCTTCCTCCTCCTCTGTGCCTTG CTGCATGTCCTTTCTGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 126, 4: 980} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!