ID: 1157063549_1157063555

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1157063549 1157063555
Species Human (GRCh38) Human (GRCh38)
Location 18:44321141-44321163 18:44321169-44321191
Sequence CCTGCTTGGCCTGCTACAGGGCG CAGCTCGGACAGCTTGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 15, 3: 34, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!