ID: 1157082863_1157082870

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1157082863 1157082870
Species Human (GRCh38) Human (GRCh38)
Location 18:44546749-44546771 18:44546782-44546804
Sequence CCTTTTTCTTTTTTTTTTCCTTT AGGGGGTTCTTTACAGGACTAGG
Strand - +
Off-target summary {0: 3, 1: 136, 2: 1848, 3: 30943, 4: 49671} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!