ID: 1157085558_1157085563

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1157085558 1157085563
Species Human (GRCh38) Human (GRCh38)
Location 18:44577061-44577083 18:44577079-44577101
Sequence CCCTCTATATCCTCTCCATTGCC TTGCCTTTTCTGTGAAATGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 155, 4: 1103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!