ID: 1157216157_1157216160

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1157216157 1157216160
Species Human (GRCh38) Human (GRCh38)
Location 18:45785436-45785458 18:45785452-45785474
Sequence CCAGAAAGAGCCTTGGCGAGTCT CGAGTCTCAGCACAGTCAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!