ID: 1157298857_1157298863

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1157298857 1157298863
Species Human (GRCh38) Human (GRCh38)
Location 18:46465374-46465396 18:46465402-46465424
Sequence CCCAGACCTTATCAATATCTACC CCTCTGCCCACTTCCTGCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 64, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!