ID: 1157320609_1157320615

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1157320609 1157320615
Species Human (GRCh38) Human (GRCh38)
Location 18:46631180-46631202 18:46631220-46631242
Sequence CCGCAGTGTTACCCTCAGAGCAA AAACTGGAGAGATACACATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!