ID: 1157327391_1157327394

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1157327391 1157327394
Species Human (GRCh38) Human (GRCh38)
Location 18:46678932-46678954 18:46678953-46678975
Sequence CCAGGCCCTGGGGTCTGCTGTGA GAGAAGTCCCGCCTTCACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 463} {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!