ID: 1157341198_1157341201 |
View in Genome Browser |
Spacer: 4 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1157341198 | 1157341201 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 18:46779996-46780018 | 18:46780023-46780045 |
Sequence | CCTGCCATCTTCTCCAGATAACT | TCCTTTTGAGAGACAACTCTTGG |
Strand | - | + |
Off-target summary | No data | {0: 17, 1: 200, 2: 191, 3: 170, 4: 310} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |