ID: 1157341198_1157341203

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1157341198 1157341203
Species Human (GRCh38) Human (GRCh38)
Location 18:46779996-46780018 18:46780034-46780056
Sequence CCTGCCATCTTCTCCAGATAACT GACAACTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 17, 1: 171, 2: 183, 3: 131, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!