ID: 1157341198_1157341204 |
View in Genome Browser |
Spacer: 16 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1157341198 | 1157341204 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 18:46779996-46780018 | 18:46780035-46780057 |
Sequence | CCTGCCATCTTCTCCAGATAACT | ACAACTCTTGGCCTGTTACTGGG |
Strand | - | + |
Off-target summary | No data | {0: 17, 1: 184, 2: 186, 3: 148, 4: 230} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |