ID: 1157353702_1157353714

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1157353702 1157353714
Species Human (GRCh38) Human (GRCh38)
Location 18:46914562-46914584 18:46914590-46914612
Sequence CCCCCCAACTCCACCCCCGACAC TCTGAAAAGCAAAGGCACCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!