ID: 1157371410_1157371420

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1157371410 1157371420
Species Human (GRCh38) Human (GRCh38)
Location 18:47115928-47115950 18:47115977-47115999
Sequence CCATCTTTCCTGAAGAAAAAGAT CCCTTCCTTTGTCCTGATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 593} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!