ID: 1157452190_1157452197

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1157452190 1157452197
Species Human (GRCh38) Human (GRCh38)
Location 18:47797166-47797188 18:47797180-47797202
Sequence CCCCGAGAAGCCACCCCTGTGGC CCCTGTGGCCTGCTTCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!