ID: 1157492514_1157492519

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1157492514 1157492519
Species Human (GRCh38) Human (GRCh38)
Location 18:48134363-48134385 18:48134397-48134419
Sequence CCAACACCATTCTATTAGGACAG CAGCTAAAACGAAGGAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!