ID: 1157507522_1157507527 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1157507522 | 1157507527 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 18:48239137-48239159 | 18:48239154-48239176 |
| Sequence | CCTCATCCCCCACAGTAGCTGCA | GCTGCAGCAAGCCCCACTCAAGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 47, 2: 121, 3: 406, 4: 4056} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||