ID: 1157578119_1157578124

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1157578119 1157578124
Species Human (GRCh38) Human (GRCh38)
Location 18:48757563-48757585 18:48757594-48757616
Sequence CCATATGTGATGACAGAGTCAGA GGTTCACTGTTATCTGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!