ID: 1157601600_1157601619

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1157601600 1157601619
Species Human (GRCh38) Human (GRCh38)
Location 18:48896624-48896646 18:48896675-48896697
Sequence CCTCATCTTGTTGGCCAGGACCC CACAGCTTCCAGGCAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!