ID: 1157703801_1157703807

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1157703801 1157703807
Species Human (GRCh38) Human (GRCh38)
Location 18:49783756-49783778 18:49783800-49783822
Sequence CCAGTTGTGGCAGCTGCTCTGAA CTGGCCAAGTAGAGTAAGGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 45, 4: 1189} {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!