ID: 1157718585_1157718592

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1157718585 1157718592
Species Human (GRCh38) Human (GRCh38)
Location 18:49906366-49906388 18:49906391-49906413
Sequence CCCCATCTTCCCCACCATGATCT TGCCCTGAGCTGCCACAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 46, 4: 372} {0: 1, 1: 0, 2: 4, 3: 16, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!