ID: 1157718586_1157718592

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1157718586 1157718592
Species Human (GRCh38) Human (GRCh38)
Location 18:49906367-49906389 18:49906391-49906413
Sequence CCCATCTTCCCCACCATGATCTG TGCCCTGAGCTGCCACAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196} {0: 1, 1: 0, 2: 4, 3: 16, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!