ID: 1157721273_1157721280

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1157721273 1157721280
Species Human (GRCh38) Human (GRCh38)
Location 18:49926435-49926457 18:49926467-49926489
Sequence CCTTCTGATATGAGCGAGTTGTT GGTCCCAGTGGGACAGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!