ID: 1157733506_1157733512

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1157733506 1157733512
Species Human (GRCh38) Human (GRCh38)
Location 18:50025401-50025423 18:50025423-50025445
Sequence CCCTCTGTGATCCCCTTAAAAAC CTCCAGCCCGGAACTCCTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 13, 3: 59, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!