ID: 1157751152_1157751154

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1157751152 1157751154
Species Human (GRCh38) Human (GRCh38)
Location 18:50179645-50179667 18:50179665-50179687
Sequence CCAGCACTAGCACAGAAGGCAAT AATGCACCCCTGCTGCTGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!