ID: 1157816017_1157816022

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1157816017 1157816022
Species Human (GRCh38) Human (GRCh38)
Location 18:50729878-50729900 18:50729893-50729915
Sequence CCACAGAGCAGGAGACCCCCAGA CCCCCAGAGAAAGCCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 44, 4: 352} {0: 1, 1: 0, 2: 0, 3: 24, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!