ID: 1157849026_1157849035

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1157849026 1157849035
Species Human (GRCh38) Human (GRCh38)
Location 18:51030419-51030441 18:51030436-51030458
Sequence CCCCCGCCGCAGGGCGGCCCGGG CCCGGGAGCTCGAGGCGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 319} {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!