ID: 1157849110_1157849129

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1157849110 1157849129
Species Human (GRCh38) Human (GRCh38)
Location 18:51030662-51030684 18:51030698-51030720
Sequence CCCGCGCACCCCGCCTGTGGCTT CGGGCTCCCGACGACGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 436} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!