ID: 1157858443_1157858450

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1157858443 1157858450
Species Human (GRCh38) Human (GRCh38)
Location 18:51121401-51121423 18:51121427-51121449
Sequence CCACCAGAGTGGGCGCCCAGGCA GAGGCACCAAGTGTGAGCGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 21, 2: 74, 3: 279, 4: 725}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!