ID: 1157865060_1157865064

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1157865060 1157865064
Species Human (GRCh38) Human (GRCh38)
Location 18:51175635-51175657 18:51175651-51175673
Sequence CCAGGTGGCCATTTCCACATTCA ACATTCACCAAGAGAGGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 177} {0: 1, 1: 0, 2: 2, 3: 21, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!