ID: 1157887197_1157887199

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1157887197 1157887199
Species Human (GRCh38) Human (GRCh38)
Location 18:51380281-51380303 18:51380297-51380319
Sequence CCCTGATCATTTTGAGGCTCATG GCTCATGAAAGACTACCCTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!