ID: 1157923019_1157923029

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1157923019 1157923029
Species Human (GRCh38) Human (GRCh38)
Location 18:51733267-51733289 18:51733319-51733341
Sequence CCCTCAAGTCTGTATCAGCCCAC TCACTAACTGCATCCTCTACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!