ID: 1158075087_1158075091

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1158075087 1158075091
Species Human (GRCh38) Human (GRCh38)
Location 18:53518614-53518636 18:53518629-53518651
Sequence CCATTTTTATTTTTTCCTCTTAG CCTCTTAGTGGGTCCTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 25, 3: 285, 4: 2736} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!