ID: 1158089272_1158089279

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1158089272 1158089279
Species Human (GRCh38) Human (GRCh38)
Location 18:53691757-53691779 18:53691801-53691823
Sequence CCCTCAAATTCTATAACAACCCC ATAGATCACCGAGCTTTTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!