ID: 1158124479_1158124484

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1158124479 1158124484
Species Human (GRCh38) Human (GRCh38)
Location 18:54086285-54086307 18:54086322-54086344
Sequence CCTTGGAAACTCCTTATTCAGAT TGCTTTTTTTCAGATAGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!