ID: 1158195669_1158195672

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1158195669 1158195672
Species Human (GRCh38) Human (GRCh38)
Location 18:54882555-54882577 18:54882600-54882622
Sequence CCTCTGATACCATTATGTATTTG GTGCTATCCAGGCTCAACGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!