ID: 1158231152_1158231159

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1158231152 1158231159
Species Human (GRCh38) Human (GRCh38)
Location 18:55256921-55256943 18:55256965-55256987
Sequence CCTGTTATTCTGGAAAGTAAAGC TTCCAGGTATAGGACCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189} {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!