ID: 1158265639_1158265644

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1158265639 1158265644
Species Human (GRCh38) Human (GRCh38)
Location 18:55658068-55658090 18:55658098-55658120
Sequence CCAATTTGAATGGGGCTAACTTG ACTAGGATATTGCGGAATCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!