ID: 1158434644_1158434655

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1158434644 1158434655
Species Human (GRCh38) Human (GRCh38)
Location 18:57427723-57427745 18:57427755-57427777
Sequence CCATCCGCTGACCTTCGCCCGGT AGCCCGGCCGCGGCCTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42} {0: 1, 1: 0, 2: 3, 3: 29, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!