ID: 1158490763_1158490768

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1158490763 1158490768
Species Human (GRCh38) Human (GRCh38)
Location 18:57907469-57907491 18:57907491-57907513
Sequence CCTGAGCCCTGAGGATGGAGGCA ATGGAGAAAAGAAATTAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 87, 4: 1141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!