ID: 1158527997_1158528000

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1158527997 1158528000
Species Human (GRCh38) Human (GRCh38)
Location 18:58232557-58232579 18:58232577-58232599
Sequence CCGTAATTGATCTGTGTAACCGG CGGAGAAAATACATATCCTATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!