ID: 1158572893_1158572900

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1158572893 1158572900
Species Human (GRCh38) Human (GRCh38)
Location 18:58611891-58611913 18:58611912-58611934
Sequence CCACAGGGTGCCGCCCTGGCAGC GCTCACTGCACGCTGGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 221} {0: 1, 1: 0, 2: 2, 3: 16, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!