ID: 1158615293_1158615298

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1158615293 1158615298
Species Human (GRCh38) Human (GRCh38)
Location 18:58981527-58981549 18:58981566-58981588
Sequence CCAGCTGATGCATGGCATCAAGG AATGACAGATGCCACCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 9, 4: 92} {0: 2, 1: 2, 2: 4, 3: 18, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!