ID: 1158648059_1158648064

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1158648059 1158648064
Species Human (GRCh38) Human (GRCh38)
Location 18:59264874-59264896 18:59264891-59264913
Sequence CCCAGGACACCGAGCGAGGGCGC GGGCGCCTCCGCGGTCCTACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68} {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!