ID: 1158648802_1158648808

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1158648802 1158648808
Species Human (GRCh38) Human (GRCh38)
Location 18:59269093-59269115 18:59269114-59269136
Sequence CCTCGTCCAGCGGGAACTTGTCC CCCCGAAGCCGGGCCCGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68} {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!