ID: 1158674782_1158674787

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1158674782 1158674787
Species Human (GRCh38) Human (GRCh38)
Location 18:59508261-59508283 18:59508305-59508327
Sequence CCAGAGTTAGAATTCCAGTTTTA GAAACTTGCCTCACTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 68, 4: 515} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!