ID: 1158678306_1158678310

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1158678306 1158678310
Species Human (GRCh38) Human (GRCh38)
Location 18:59543031-59543053 18:59543057-59543079
Sequence CCAACAAGTATAACTTAGATTCT CCAAATTTTGGCTTCCTTCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 22, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!