ID: 1158739198_1158739206 |
View in Genome Browser |
Spacer: 27 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1158739198 | 1158739206 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 18:60120364-60120386 | 18:60120414-60120436 |
Sequence | CCATCCCCCATCTCCCTCTAATG | TCCACTTGATGAATAACCACTGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 1, 3: 67, 4: 678} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |