ID: 1158768507_1158768517

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1158768507 1158768517
Species Human (GRCh38) Human (GRCh38)
Location 18:60485742-60485764 18:60485787-60485809
Sequence CCCCACCCAAATCTCATCTTGAA TGTGAAGGCCAGGACCTGATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!