ID: 1158830599_1158830600

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1158830599 1158830600
Species Human (GRCh38) Human (GRCh38)
Location 18:61273603-61273625 18:61273655-61273677
Sequence CCAGCATCTGGGCGGAAATGAAG ATTGCATAACCTCTGTTCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!