ID: 1158868961_1158868973

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1158868961 1158868973
Species Human (GRCh38) Human (GRCh38)
Location 18:61665752-61665774 18:61665792-61665814
Sequence CCTTCCCCCTTCTCCCTCAGATG TGGACACCTGTGGGCAGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 791} {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!